Untitled

Animal (2012), 6:5, pp 815–823 & The Animal Consortium 2011 Effects of disodium fumarate on ruminal fermentation andmicrobial communities in sheep fed on high-forage diets Y. W. Zhou1, C. S. McSweeney2, J. K. Wang1 and J. X. Liu1- 1Institute of Dairy Science, MoE Key Laboratory of Molecular Animal Nutrition, College of Animal Sciences, Zhejiang University, Hangzhou, China; 2CSIRO LivestockIndustries, 306 Carmody Road, St Lucia, QLD 0467, Australia (Received 1 September 2010; Accepted 23 September 2011; First published online 11 November 2011) This study was conducted to investigate effects of disodium fumarate (DF) on fermentation characteristics and microbialpopulations in the rumen of Hu sheep fed on high-forage diets. Two complementary feeding trials were conducted. In Trial 1, sixHu sheep fitted with ruminal cannulae were randomly allocated to a 2 3 2 cross-over design involving dietary treatments of either0 or 20 g DF daily. Total DNA was extracted from the fluid- and solid-associated rumen microbes, respectively. Numbers of 16SrDNA gene copies associated with rumen methanogens and bacteria, and 18S rDNA gene copies associated with rumen protozoaand fungi were measured using real-time PCR, and expressed as proportion of total rumen bacteria 16S rDNA. Ruminal pHdecreased in the DF group compared with the control (P , 0.05). Total volatile fatty acids increased (P , 0.001), but butyratedecreased (P , 0.01). Addition of DF inhibited the growth of methanogens, protozoa, fungi and Ruminococcus flavefaciens in fluidsamples. Both Ruminococcus albus and Butyrivibrio fibrisolvens populations increased (P , 0.001) in particle-associated samples.
Trial 2 was conducted to investigate the adaptive response of rumen microbes to DF. Three cannulated sheep were fed on basaldiet for 2 weeks and continuously for 4 weeks with supplementation of DF at a level of 20 g/day. Ruminal samples were collectedevery week to analyze fermentation parameters and microbial populations. No effects of DF were observed on pH, acetate andbutyrate (P . 0.05). Populations of methanogens and R. flavefaciens decreased in the fluid samples (P , 0.001), whereas additionof DF stimulated the population of solid-associated Fibrobacter succinogenes. Population of R. albus increased in the 2nd to4th week in fluid-associated samples and was threefold higher in the 4th week than control week in solid samples. Analysis ofdenaturing gradient gel electrophoresis fingerprints revealed that there were significant changes in rumen microbiota after addingDF. Ten of 15 clone sequences from cut-out bands appearing in both the 2nd and the 4th week were 94% to 100% similar toPrevotella-like bacteria, and four sequences showed 95% to 98% similarity to Selenomonas dianae. Another 15 sequences wereobtained from bands, which appeared in the 4th week only. Thirteen of these 15 sequences showed 95% to 99% similarity toClostridium sp., and the other two showed 95% and 100% similarity to Ruminococcus sp. In summary, the microorganismspositively responding to DF addition were the cellulolytic bacteria, R. albus, F. succinogenes and B. fibrisolvens as well asproteolytic bacteria, B. fibrisolvens, P. ruminicola and Clostridium sp.
Keywords: disodium fumarate, ruminal metabolism, microbial community, sheep and the positive effects on the population of cellulolyticmicrobes, Ruminococcus albus and fungi.
The rumen microorganisms can be classified into hydrogen-producing (protozoa, cellulolytic bacteria and fungi) andhydrogen-consuming microbes (methanogens and fumarate- reducers) according to their hydrogen metabolic pathway.
Hydrogen metabolism plays a central role in regulating rumen Supplementation of disodium fumarate in the sheep diet could fermentation (Hungate, 1967; Williams and Coleman, 1997).
improve ruminal fermentation by changing the microbial com- Efficient removal of hydrogen from the rumen is beneficial to munities, indicative of the decreased methanogen population increase the rate of fermentation by eliminating its inhibitoryeffect on the microbial degradation of plant material (Wolin, 1979; McAllister and Newbold, 2008). There are other potential electron acceptors in rumen (Wolin, 1979), such as sulfate, In Trial 2, three 1.5-year-old rumen-cannulated Hu sheep nitrate and fumarate, etc. (Morgavi et al., 2010). Among them (,45 kg BW) were fed on the same basal diet as in Trial 1 fumarate is non-toxic and an intermediate of the pathways of continuously for 6 weeks, including 2 weeks of adaptation propionate formation (Russell and Wallace, 1997), and has been (without DF) and 4 weeks with DF supplementation (20 g/day).
extensively studied as an alternative electron sink (Castillo et al., Ruminal samples were collected in the morning before feeding 2004). Fumarate has been associated with favorable changes in after the first 2 weeks of adaptation and every week thereafter.
ruminal fermentation in vitro as well as in vivo (Asanuma et al., Sampling points were indicated as 0 w (no DF addition), 1 w, 2 1999a; Ungerfeld et al., 2007; Wood et al., 2009).
w, 3 w and 4 w, respectively. Rumen fermentation and microbial Methanogens (hydrogen-utilizing microbes) and fibrolytic populations were measured. Microbial diversity was analyzed microorganisms (hydrogen-producing microbes) play a pivotal using denaturing gradient gel electrophoresis (DGGE) using role in the rumen ecosystem. Interspecies hydrogen transfer has rumen samples taken from 0 w, 2 w and 4 w.
been well described in vitro, especially between cellulolyticsand methanogens (Wolin et al., 1997). Ruminococcus albus, Ruminococcus flavefaciens and all the rumen fungi and The rumen samples were filtered through four layers of protozoa produce hydrogen and they interact positively with gauze into tubes for analysis of pH, ammonia nitrogen (N) methanogens (Joblin et al., 1990; Pavlostathis et al., 1990; and volatile fatty acids (VFA). The pH of rumen fluid was determined immediately using a pH meter (Model PB-20, Addition of disodium fumarate (DF) in the diet might stimu- Sartorius, Go¨ettingen, Germany). Concentration of ammonia late alternative pathways that use fumarate as electron accep- N was determined (Model 721/721-100, Shanghai, China) tors other than carbon dioxide in the rumen, and might induce colorimetrically using a spectrometer (Searle, 1984) with major effects on the population of hydrogen utilizers and pro- ammonium chloride solution as a standard. The VFA were ducers. Fumarate tended to increase rumen microbial growth on determined using a gas chromatograph (GC-2010, Shimadzu, high-forage diet, and generally the effect of fumarate on rumen Kyoto, Japan) equipped with a Flame Ionization Detector fermentation depended on the nature of the incubated substrate and a capillary column (HP-INNOWAX, 1909N-133, Agilent with high-forage diets showing a greater response compared Technologies, Santa Clara, CA, USA ), as described elsewhere with low-forage diet (Garcı´a-Martı´nez et al., 2005).
Microbial adaptation to fumarate metabolism is important, and the whole community of hydrogen-producing microbes (cellulytic microbes, protozoa and fungi) and hydrogen-using The rumen samples were strained through four layers of microbes (methanogens) could be modified when fumarate is gauze and separated into fluid and particle parts. Total DNA added to diet. Furthermore, the effect on rumen function and was extracted from liquid- and solid-associated microbes, bacteria community of fumarate addition for an extended respectively, as described elsewhere (Chen et al., 2007 and period could be different from addition during a short-term, and 2008). Number of 16S rDNA gene copies associated with microbial populations in different ruminal fractions (fluid- and rumen methanogens and bacteria, and 18S rDNA gene copies solid-associated microbes) could respond differently to DF associated with rumen protozoa and fungi were measured addition. Thus, the objective of this study was to investigate the using real-time PCR. Primer pairs of total bacteria, fungi, pro- effects of DF on ruminal fermentation, methanogens and tozoa, methanogen, R. albus, Fibrobacter succinogenes, Butyr- fibrolytic populations in ruminal fluid and solid samples when ivibrio fibrisolvens and R. flavefaciens are listed in Table 1.
supplementing for both a short and an extended period.
Species-specific real-time qPCR was performed using Bio-RadiCycler iQ real-time PCR detection system (Bio-Rad laboratoriesInc., Hercules, CA, USA) with fluorescence detection of SYBR Green dye, as described elsewhere (Chen et al., 2008).
Animals, diets and experimental designsIn Trial 1, six Hu sheep (,45 kg BW) fitted with ruminal cannulae were randomly allocated to a 2 3 2 cross-design either Microbial diversity was analyzed by DGGE of PCR-amplified or not supplemented with 20 g DF daily. Each period lasted for genes coding for 16S rRNA (Muyzer et al., 1993). The V3 vari- 15 days. Animals were maintained in individual pens with able regions of the bacterial 16S rRNA gene from rumen sam- a daily basal diet consisting of 300 g concentrate and 700 g ples (0 w, 2 w, 4 w) in Trial 2 were amplified by a touchdown forage (concentrate/forage, 30/70) per sheep per day. The diet PCR approach using forward primer 341F-GC clamp and 534R was presumed to meet the energy requirement for maintenance (Table 1). Fast silver staining of DGGE gels was used (Ji et al., (Ministry of Agriculture of China, 2004), and contained 100 g/kg 2007). The DGGE bands of interest were cut-out. PCR products of CP, 530 g/kg of NDF and 470 g/kg of ADF. They were fed twice were cloned using TOPO TA cloning kit according to the daily at 0830 and 1630 h with free access to water. Ruminal manufacturer’s instructions (Invitrogen Corporation, San samples were collected from the cannulae in the morning before Diego, CA, USA). All products were sequenced using the the morning feeding on the last day during each period. Samples Terminator v3.1 kit (Applied Biosystems, Foster for DNA extraction were stored at 2808C. Rumen fermentation city, CA, USA). All the DNA sequences were edited manually parameters and microbial populations were measured.
and trimmed for vector contamination by ContigExpress Fumarate effect on rumen function and microbiota Table 1 Primers for real-time PCR assay and DGGE-V3 CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG DGGE 5 denaturing gradient gel electrophoresis.
aCited from Denman and McSweeney (2006).
dCited from Koike and Kobayashi (2001).
Project (Vector NTI Advance 10, Invitrogen). Sequences from Table 2 Effects of DF on ruminal pH, ammonia N, and total and indi- excised DGGE bands were searched for homology with Basic vidual VFA expressed as molar proportions of the total (n 5 3; Trial 1) Local Alignment Search Tool program.
Quantification for methanogens, protozoa, F. succinogenes, R. albus, R. flavefaciens, B. fibrisolvens and rumen fungi, were expressed as a proportion to total rumen bacterial 16S rDNA, according to the equation: relative quantifica- tion 5 22(ct target2ct total bacteria), where Ct represents threshold cycle. The results of Trial 1 were analyzed according to univariate analysis by GLM procedure of SPSS (SPSS, 2006) with time and group as fixed factors. Multiple comparisons among means of Trial 2 were performed using the least significant DF 5 disodium fumarate; N 5 nitrogen; VFA 5 volatile fatty acids.
difference analysis (SPSS, 2006). Differences among means *P , 0.05; **P , 0.01; ***P , 0.001; ns 5 non-significant.
with P , 0.05 were accepted as representing statisticallysignificant differences; differences among means with0.05 , P , 0.10 were accepted as representing tendencies.
The abundance of microbial populations relative to the total bacterial 16S rDNA is shown in Table 3. Methanogens andprotozoa were less abundantly represented in the total bacterial16S rDNA of fluid samples (from 0.80% and 0.80% to 0.14% and 0.03%, respectively). R. albus represented a greater Trial 1: fermentation parameters and microbial populations proportion of the solid bacteria, but was less predominant in the The rumen fermentation parameters in Trial 1 are presented liquid bacterial population of the animals fed DF. The abun- in Table 2. Average ruminal pH increased sharply in the DF dance of fungi within the microbial community decreased in the group compared with the control (P , 0.05). Ammonia N con- fluid (P , 0.001), but increased in the solid (P 5 0.03) samples.
centration did not change (P . 0.05). Total VFA concentrationsincreased (P , 0.001), and minor increases (P , 0.05) in acetate (2 molar percent) were at the expense of similar No apparent effect of DF was observed (P . 0.05) on pH decreases in molar byturate proportions (P , 0.05).
value (Table 4). Addition of DF induced dynamic changes on ammonia N concentration (P 5 0.0006), with an increase by 0.20% in 1 w and 4 w relative to total bacterial 16S rDNA, 67% in 2 w compared with 0 w and a decease to the 0 w respectively (Table 5). Solid-associated methanogens increased level in 3 w and 4 w. Total VFA increased during the 4 weeks in 1 w and then decreased in 2 w and 3 w, but again increased when DF was added, and the concentration in 2 w, 3w and 4 to 0 w levels in 4 w. The abundance of methanogens was w were 28%, 23% and 22% higher than that of control, higher in fluid than in solid samples, whereas the protozoa respectively. Proportions of acetate and butyrate were not represented more of the solid as compared with liquid microbes altered by DF addition. The proportion of propionate was not (Table 5). The protozoal abundance in fluid samples was decreased to the lowest numbers at the end of 2 w, butrecovered to original (0 w) values in 4 w.
The abundance of solid-associated F. succinogenes (fuma- rate-reducers) within the solid-associated microbial population The abundance of methanogens within the microbial com- increased four times in 1 w, remained stable in 2 w, but its munity in fluid samples decreased from 1.00% to 0.69% and importance in the microbial population decreased from 3 w.
However, after 4 weeks of DF supplementation this bacterial Table 3 Effect of DF on microbial population in fluid and solid ruminal group seemed twice as important as compared with a situation samples (% of total bacterial 16S rDNA; n 5 3; Trial 1) without DF supplementation (0 w). The abundance of R. albus within the fluid-associated microbial population remainedstable in 1 w, increased twice and three times in 2 w and 3 w, respectively, and its importance increased 11 times after4 weeks of DF supplementation, compared with that in 0 w. Although the abundance of R. albus within the solid- associated microbial population remained stable during the first 3 weeks, at the end of experiment it increased to four times that in 0 w. A decrease (P , 0.05) was observed on the populations of R. flavefaciens in both solid and fluid samples at the end of 4 w, compared with that at 0 w. Addition of DF increased the importance of fungi in both fluid and solid samples throughout Trial 2 (P , 0.001). The number of fungi in the microbial population of fluid and solid samples in 4 w was approximately three times that of 0 w.
The DGGE fingerprints revealed significant changes in rumen microbiota after DF addition (Figure 1). Bands a, b and c were shown in each animal only in 2 w and 4 w, whereas bands g, h and i were only shown in 4 w. DGGE profiles were relatively consistent within three replicate animals. Cut-out of DGGE bands and sequencing results are summarized in Table 6. Ten of 15 clone sequences in the six bands, a, b and c, which were more pronounced after 2 w and 4 w, showed *P , 0.05; **P , 0.01; ***P , 0.001; ns 5 non-significant.
94% to 100% similarity to Prevotella-like bacteria. Four Table 4 Dynamic change in pH and fermentation parameters with addition of DF (n 5 3; Trial 2) DF 5 disodium fumarate.
*P , 0.05; ns 5 non-significant.
Fumarate effect on rumen function and microbiota Table 5 Trial 2: Effect of long-term addition of DF on the dynamic changes of microbial population in fluid and solid samples (n 5 3) Time (week) after after adding DF (20 g/day) appeared in 4 w were 95% to 99% related to Clostridium sp., and the other two showed 95% and 100% similarity to g
h
i
Ruminococcus sp. A total of 17 sequences were submitted toGenbank with the accession number: HQ162700 to HQ162716.
Ruminal fermentationAddition of monosodium fumarate in vitro increased acetate,propionate and total VFA and decreased the ratio of acetateto propionate (Yu et al., 2010). Carro and Ranilla (2003)showed that fumarate could beneficially affect in vitro rumenfermentation of concentrate feeds by increasing the pro- a b
a b c
c
ductions of both acetate and propionate. An increase in totalVFA concentration and basically no change in the proportionof the individual fatty acids were observed in this study,although a slight increase in acetate and decrease in butyratewere observed in Trial 1 (Table 2). It seems that both acetateand propionate are formed to a same extent from DF. Thepossibility for both acetate and propionate formation from DF Figure 1 Denaturing gradient gel electrophoresis profiles of the ruminalbacterial community with disodium fumarate (DF) addition for 4 weeks in was indicated before (Ungerfeld and Kohn, 2006). The increase Hu-sheep. A1, A2, A3 represent the sheep number in Trial 2; symbols a, b of total VFA concentration in both trials indicates the positive and c represent bands appearing in each animal through DF supplementa- effects of DF addition on ruminal fermentation.
tion in both 2 w and 4 w; and g, h and i represent bands appearing insamples of animals after 4 weeks of DF supplementation (2 w and 4 w aresampling points).
Interaction between methanogens and protozoaThe abundance of methanogens within the microbial popula- sequences were related to Selenomonas dianae (95% to tion decreased significantly in the fluid-associated samples in 98% similarity); and one was 100% similar to B. fibrisolvens.
both trials (Tables 3 and 5). The abundance of methanogens Thirteen of 15 sequences in three bands g, h and i that in solid samples in Trial 1 showed no significant changes; however, particle-associated abundance in Trial 2 increased fermentation, and decrease the negative feed-back effect of in 1 w, and decreased in 2 and 3 w compared with 0 w, hydrogen on microbes, which in turn improves the growth of respectively, and then increased to the same level as 0 w in fiber-degrading microorganisms. F. succinogenes, R. flave- 4 w. These results indicated that DF addition provides dif- faciens and R. albus are the representative cellulolytic spe- ferent effects on fluid- and solid-associated methanogens cies in the rumen (Forsberg et al., 1997). Moreover, several with solid abundance showing more variable changes.
of them also might reduce fumarate. F. succinogenes are It had been estimated that under ruminal conditions, known to have high fumarate-reducing activity (Asanuma fumarate reduction should be more exergonic than metha- et al., 1999b). R. flavefaciens could hydrolyze cellulose and nogenesis in terms of Gibbs-free energy released per pair of use fumarate as the main electron acceptor producing suc- electrons incorporated. The DG (kJ/2H) for fumarate reduc- cinate (Stewart et al., 1988). Accordingly, these bacteria tion and methanogenesis is 263.6 and 216.9, respectively were expected to be stimulated either due to their fumarate- (Ungerfeld and Kohn, 2006). Therefore, the decrease of fluid- reducing capacity or due to effective removable of hydrogen.
associated methanogens in this study verified that the capacity However, changes due to fumarate addition were variable of methanogens to compete for hydrogen with fumarate- and different between fluid and solid phase as well as long- reducers was weakened by fumarate addition. However, it is surprising that this is not associated with changes in propionate As one of the main fumarate-reducers, the change of F.
succinogenes in both solid and fluid phases was not con- Some methanogens are associated with the external sur- sistent between two trials. In Trial 1, for a short-term of face of protozoa, and/or are endosymbionts, living free 15 days, a decrease in the solid phase was observed with no within the protozoal cytoplasm (Williams and Coleman, change in the fluid phase, whereas in Trial 2, solid-associated 1997). In this study, the abundance of the protozoa popu- F. succinogenes were more abundant during the 4 weeks of lation within the fluid samples was decreased compared DF addition compared with 0 w levels (Table 5). R. albus with control in Trial 1 (Table 3), whereas in Trial 2 the abundance increased in solid samples, but declined in fluid extended feeding of DF caused their abundance in both solid samples in Trial 1 (Table 3); whereas in Trial 2, R. albus and fluid samples to recover to 0 w levels (Table 5). It is increased in fluid samples throughout the 4 weeks of DF suggested that DF may cause a transient effect on protozoa.
addition, although their abundance in solid samples did not Protozoa serve not only as host for methanogens, but also change during the first 3 weeks and increased to nearly four produce hydrogen in large quantities in a specialized orga- times the number of 0 w in 4 w (Table 5). Stimulation of nelle (hydrogenosome; Morgavi et al., 2010). This hydrogen R. albus could be linked to interspecies hydrogen transfer, is metabolized by methanogens that are found inside (Finlay that is, hydrogen produced by R. albus could be consumed by et al., 1994) or in close association with protozoal cells fumarate-reducing bacteria resulting in little accumulation of (Stumm et al., 1982). The interaction between methanogens hydrogen. The low partial pressure of hydrogen could facil- and protozoa is a typical example of interspecies hydrogen itate electron disposal in R. albus and result in faster growth transfer, which favors both of them (Hillman et al., 1988; Ushida and Jouany, 1996). Both populations of methanogens B. fibrisolvens is one of the protein-degrading species in and protozoa in fluid samples decreased significantly with rumen with abilities to digest cellulose, although not as the addition of DF, but remained relatively stable in particle effective as Ruminococcus or Fibrobacter sp. Interestingly, samples in both trials. Krumholz et al. (1983) found that the some similarity can be seen in the concentration of ammonia methanogenic activity in the rumen fluid was highest in N and the abundance of solid-associated (Tables 2, 4 and 5) fractions containing large numbers of protozoa. It is also or fluid-associated B. fibrisolvens (Tables 2 and 3). Never- reported that the capacity of competition by methanogens theless, in Trial 1, solid-associated B. fibrisolvens is inversely for hydrogen with fumarate-reducers was increased when related with ammonia N, whereas fluid-associated bacteria associated with protozoa (Finlay et al., 1994). This is in line are positively correlated with ammonia N concentration.
with good growth by methanogens and protozoa when liv- B. fibrisolvens require ammonia N for optimal growth when ing in symbiosis (Wolin, 1974), and with the fact that feeding fibrous basal diets (Williams and Coleman, 1997).
fumarate is more effective in reducing methane production The effects of DF addition on protein degradation need in protozoa-depleted ruminal fluid (Asanuma et al., 1999b).
Interaction between methanogens and fibrolytic Most of the clone sequences from bands a, b and c in both 2 w From the point of view of the syntrophy between R. albus and 4 w were similar with Prevotella-like bacteria and (hydrogen-producing) and methanogens (hydrogen-consuming), S. dianae (Figure 1; Table 6), suggesting that the addition of the increased importance of R. albus and the decreased fumarate had a stable and stimulating effect on their growth.
abundance of methanogens implied that fumarate-reducing Two of the sequences in band a were affiliated to Prevotella bacteria could successfully compete with methanogens for ruminicola (98%; AB501151.1). Two of the sequences in band hydrogen when enough fumarate was supplied. Addition b were affiliated to Selenomonas ruminantium isolate M40 of DF in vivo may stimulate the use of hydrogen during (AY685142.1; Table 6). Fumarate reduction has been reported Fumarate effect on rumen function and microbiota Table 6 Affiliation of partial 16S rDNA (V3 region) gene sequences obtained from excised bands of DGGE fingerprint with their closeisolates in GenBank (sequence length 5 182 to 194 bp) Close cultured relative (Genbank accession no.) Selenomonas ruminantium isolate M40 (AY685142.1) to be catalyzed by fumarate reductase in P. ruminicola and Ruminococcus sp. in 4 w. The appearance of Ruminococcus S. ruminantium (Henderson, 1980). There is also evidence that sp. in 4 w was verified by real-time PCR results, suggesting S. ruminantium can utilize hydrogen produced by other rumen that R. albus increased throughout the experiment and microorganisms (Marvin-Sikkema et al., 1990). There were reached its highest abundance in 4 w in the current experi- 93% of the clone sequences in both 2 w and 4 w represented ment, but the abundance of R. flavefaciens decreased.
by Prevotella sp. and Selenomonas sp., which could indicate R. flavefaciens may not compete with R. albus for the supply the involvement of Prevotella and Selenomonas-like bacteria of hydrogen during interspecies hydrogen transfer. The in fumarate reduction both during the early and late stage of 15 sequences in bands a, b and c belonged to the phylumn of fumarate treatment. Nevertheless, an indirect effect of fumarate bacteroidetes (67%) and firmicutes (33%), whereas all the on these bacterial species cannot be excluded.
15 sequences in bands g, h and i belonged to the phylum of One of the sequences from band a had 100% similarity with firmicutes. It is indicated that a certain group of bacteria B. fibrisolvens. The reveal of B. fibrisolvens in DGGE bands belonging to the phylum of Bacteroidetes (Prevotella sp.) agreed with the results of real-time PCR. The abundance of and Firmicutes (S. dianae) grows faster after adding DF and B. fibrisolvens increased and their abundance in fluid samples may keep their activity stable for 4 weeks. Another group of was higher in 3 w and 4 w than during earlier samplings.
Firmicutes, such as Clostridium sp., responded to DF addition P. ruminicola and B. fibrisolvens are important proteolytic bac- in week 4, but not at the early stage.
teria in the rumen (Wallace et al., 1997), indicating that some This DGGE study suggested that the dominant group protein-degrading bacteria responded to DF addition.
in the microbial community composition shifted from the Of the10 clone sequences in bands a and b, 40% showed phylum of Bacteroidetes to Firmicutes (Clostridia Class) after 95% to 98% similarity to S. dianae (AF287801.1). As discussed addition of fumarate. Analysis of DGGE based on partial above, the abundance of R. albus increased significantly in 16S rDNA sequences could capture some corresponding both fluid and solid samples during the 4 weeks, especially in predominant species, but only gives a general view of com- 4 w. Increased growth of R. albus through fumarate addition munity shifts (Kocherginskaya et al., 2005). There is a need was reported before in co-cultures with Selenomonas lactilytica of more precise analysis based on functional fumarate (Asanuma and Hino, 2000). It is further confirmed and reductase (frdA) gene or full-length of 16S rDNA gene clone approved by the appearance of Selenomonassp. in DGGE libraries (Makkar and McSweeney, 2005). In their study on analysis in 2 w and 4 w (Figure 1; Table 6). Interspecies diverisity of frdA clones recovered from the rumen of cattle hydrogen transfer might be the reason for their co-growth. The on high-forage diets (Hattori and Matsui, 2008), three clusters hydrogen produced by R. albus may be consumed by S. dianae.
represented by cultured isolates Proteus vulgaris, Pasteurel a Asanuma and Hino (2000) indentified two strains of Seleno- multocida and Shewanella putrefaciens were detected in the monas having a high capacity for fumarate reduction by using library from one animal; two abundant clusters were repre- hydrogen as an electron donor. Therefore, S. dianae could be sented by S. putrefaciens and Pasteurel a spp., accounting for one of the potential fumarate-reducers as well.
56% and 33% of total clones, whereas a less abundant cluster Of the clone sequences in bands g, h and i, 87% was (9% of total frd clones) represented by P. vulgaris detected as closely related to Clostridium sp., and the rest related to their nearest neighbor. In our study, both Proteus spp. and Shewanella spp. were detected in bands a, b and c from 2 w Henderson C 1980. The influence of extracellular hydrogen on the metabolism and 4 w, but Pasteurel a spp. was not found.
of Bacteroides ruminicola, Anaerovibrio lipolytica and Selenomonas ruminan-tium. Journal of General Microbiology 119, 485–491.
In summary, the DF addition improves in vivo rumen fer- Hillman K, Lloyd D and Williams AG 1988. Interactions between the mentation in sheep on high-forage diets as suggested from methanogen Methanosarcina barkeri and rumen holotrich ciliate protozoa.
increasing total VFA concentration. Addition of DF resulted in Letters in Applied Microbiology 7, 49–53.
a decreased methanogen population and positive effects on Hu WL, Liu JX, Ye JA, Wu YM and Guo YQ 2005. Effect of tea saponin on rumen the population of cellulolytic micoorganisms, R. albus. DGGE fermentation in vitro. Animal Feed Science and Technology 120, 333–339.
analysis indicated that Prevotella-like bacteria, S. dianae and Hungate RE 1967. Hydrogen as an intermediate in the rumen fermentation.
Archives of Microbiology 59, 158–164.
Clostridium sp. responded to DF addition at different stages.
Ji YT, Qu CQ and Cao BY 2007. Optimized method of DNA silver staining inpolyacylamide gels electrophoresis. Electrophoresis 28, 1173–1175.
Joblin KN, Naylor GE and Williams AG 1990. Effect of methanobrevibactersmithii on xylanolytic activity of anaerobic ruminal fungi. Applied and This study was supported partly by grants from the National Environmental Microbiology 56, 2287–2295.
Natural Science Foundation of China (No. 30972105) and China– Kocherginskaya SA, Cann IKO and Mackie RI 2005. Denaturing gradient Australia Special Fund for Science and Technology (No.
gel electrophoresis. In Methods in gut microbial ecology for ruminants (ed.
HPS Makkar and CS McSweeney), pp. 119–128. Springer, Dordrecht, theNetherlands.
Koike S and Kobayashi Y 2001. Development and use of competitive PCR assays for the rumen cellulolytic bacteria: Fibrobacter succinogenes, Ruminococcusalbus and Ruminococcus flavefaciens. FEMS Microbiology Letters 204, Arakaki LC, Gaggiotti MC, Cannillia ML, Valtorta S, Gallardo MR, Conti RG, Gregoret F, Quaino O, Kudo H and Takenaka A 2005. Evaluation of soybean Krumholz LR, Forsberg CW and Veira DM 1983. Association of methanogenic silage in dairy cows under grazing conditions in Argentina: effects on rumen bacteria with rumen protozoa. Canadian Journal of Microbiology 29, microorganisms. Proceedings of Japanese Society for Rumen Metabolism and Makkar HPS and McSweeney CS 2005. Methods in gut microbial ecology for Asanuma N and Hino T 2000. Activity and properties of fumarate reductase in ruminants. Springer, Dordrecht, the Netherlands.
ruminal bacteria. The Journal of General and Applied Microbiology 46,119–125.
Marvin-Sikkema FD, Richardson AJ, Stewart CS, Gottschal JC and Prins RA1990. Influence of hydrogen-consuming bacteria on cellulose degrada- Asanuma N, Iwamoto M and Hino T 1999a. The production of formate, a tion by anaerobic fungi. Applied and Environmental Microbiology 56, substrate for methanogenesis, from compounds related with the glyoxylate cycle by mixed ruminal microbes. Animal Science Journal 70, 67–73.
McAllister TA and Newbold CJ 2008. Redirecting rumen fermentation to Asanuma N, Iwamoto M and Hino T 1999b. Effect of the addition of fumarate on reduce methanogenesis. Australian Journal of Experimental Agriculture 48, methane production by ruminal microorganisms in vitro. Journal of Dairy Ministry of Agriculture of China 2004. Feeding standard of meat-producing Carro MD and Ranilla MJ 2003. Influence of different concentrations of sheep and goats (NY/T 816-2004). China Agricultural Press, Beijing, China.
disodium fumarate on methane production and fermentation of concentratefeeds by rumen micro-organisms in vitro. British Journal of Nutrition 90, Morgavi DP, Forano E, Martin C and Newbold CJ 2010. Microbial ecosystem and methanogenesis in ruminants. Animal 4, 1024–1036.
Castillo C, Benedito JL, Me´ndez J, Pereira V, Lo´pez-Alonso M, Miranda M and Muyzer G, de Waal EC and Uitterlinden AG 1993. Profiling of complex microbial Herna´ndez J 2004. Organic acids as a substitute for monensin in diets for beef populations by denaturing gradient gel electrophoresis analysis of polymerase cattle. Animal Feed Science and Technology 115, 101–116.
chain reaction-amplified genes coding for 16S rRNA. Applied and EnvironmentalMicrobiology 59, 695–700.
Chen XL, Wang JK, Wu YM and Liu JX 2007. Effect of form of nitrogen onpopulations of fibre-associated ruminal microbes in pre-treated rice straw in Pavlostathis SG, Miller TL and Wolin MJ 1990. Cellulose fermentation by vitro. Journal of Animal and Feed Sciences 16, 95–100.
continuous cultures of Ruminococcus albus and Methanobrevibacter smithii.
Applied Microbiology and Biotechnology 33, 109–116.
Chen XL, Wang JK, Wu YM and Liu JX 2008. Effects of chemical treatments ofrice straw on rumen fermentation characteristics, fibrolytic enzyme activities Russell JB and Wallace RJ 1997. Energy-yielding and energy-consuming and populations of liquid- and solid-associated ruminal microbes in vitro.
reactions. In The rumen microbial ecosystem, 2nd edition (ed. PN Hobson and Animal Feed Science and Technology 141, 1–14.
CS Stewart), pp. 246–282. Blackie Academic and Professional, London, UK.
Denman SE and McSweeney CS 2006. Development of a real-time PCR assay for Searle LP 1984. The berthelot or indophenol reaction and its use in the analytical monitoring anaerobic fungal and cellulolytic bacterial populations within the chemistry of nitrogen: a review. Analyst 109, 549–568.
rumen. FEMS Microbiology Ecology 58, 572–582.
SPSS 2006. SPSS Base 13.0 for Windows user’s guide. SPSS Inc., Chicago, IL.
Denman SE, Tomkins NW and McSweeney CS 2007. Quantitation and diversity Stewart CS, Flint HJ and Bryant MP 1988. The rumen bacteria. In The rumen analysis of ruminal methanogenic populations in response to the antimethanogenic microbial ecosystem, 1st edition (ed. PN Hobson), pp. 21–75. Elsevier Applied compound bromochloromethane. FEMS Microbiology Ecology 62, 313–322.
Finlay BJ, Esteban G, Clarke KJ, Williams AG, Embley T and Hirt RP 1994. Some Stumm CK, Gijzen HJ and Vogels GD 1982. Association of methanogenic rumen ciliates have endosymbiotic methanogens. FEMS Microbiology Letters bacteria with ovine rumen ciliates. British Journal of Nutrition 47, 95–99.
Ungerfeld EM and Kohn RA 2006. The role of thermodynamics in the control of Forsberg CW, Cheng KJ and White BA 1997. Polysaccharide degradation in the ruminal fermentation. In Ruminant physiology. Digestion, metabolism and rumen and large intestine. In Gastrointestinal microbiology (ed. RI Mackie and impact of nutrition on gene expression, immunology and stress (ed. K Sejrsen, T BA White), pp. 319–379. Chapman and Hall, New York, USA.
Hvelplund and MO Nielsen), pp. 55–85. Wageningen Academic Publishers, Garcı´a-Martı´nez R, Ranilla MJ, Tejido ML and Carro MD 2005. Effects of disodium fumarate on in vitro rumen microbial growth, methane production and Ungerfeld EM, Kohn RA, Wallace RJ and Newbold CJ 2007. A meta-analysis of fermentation of diets differing in their forage : concentrate ratio. British Journal fumarate effects on methane production in ruminal batch cultures. Journal of Hattori K and Matsui H 2008. Diversity of fumarate reducing bacteria in the Ushida K and Jouany J 1996. Methane production associated with rumen- bovine rumen revealed by culture dependent and independent approaches.
ciliated protozoa and its effect on protozoan activity. Letters in Applied Fumarate effect on rumen function and microbiota Wallace RJ, Onodera R and Cotta MA 1997. Metabolism of nitrogen- Wolin MJ 1979. The rumen fermentation: a model for microbial interactions in containing compounds. In The rumen microbial ecosystem, 2nd edition (ed.
anaerobic ecosystems. In Advances in microbial ecology (ed. M Alexander), PN Hobson and CS Stewart), pp. 283–328. Blackie Academic & Professiional, Vol. 3 pp. 49–77. Plenum Press, New York.
Wolin M, Miller T and Stewart C 1997. Microbe–microbe interactions. In The Williams AG and Coleman GS 1997. The rumen protozoa. In The rumen rumen microbial ecosystem (ed. PN Hobson and CS Stewart), pp. 467–491.
microbial ecosystem, 2nd edition (ed. PN Hobson and CS Stewart), pp. 73–139.
Blackie Academic & Professional, London, UK.
Blackie Academic & Professiional, London, UK.
Wood TA, Wallace RJ, Rowe A, Price J, Ya´n˜ez-Ruiz DR, Murray P and Newbold CJ Williams AG, Withers SE and Joblin KN 1994. The effect of cocultivation with 2009. Encapsulated fumaric acid as a feed ingredient to decrease ruminal hydrogen-consuming bacteria on xylanolysis by Ruminococcus flavefaciens.
methane emissions. Animal Feed Science and Technology 152, 62–71.
Yu CW, Chen YS, Cheng YH, Cheng YS, Yang CMJ and Chang CT 2010. Effects of Wolin MJ 1974. Metabolic interactions among intestinal microorganisms.
fumarate on ruminal ammonia accumulation and fiber digestion in vitro and American Journal of Clinical Nutrition 27, 1320–1328.
nutrient utilization in dairy does. Journal of Dairy Science 93, 701–710.

Source: http://dairyscience.zju.edu.cn/paper/2012/Animal(2012)6(5)-815-823_ZhouYW.pdf