Invivogen.net

pORF9-mIL-15
An expression vector containing the murine Interleukin 15 open reading frame PRODUCT INFORMATION
• mIL-15 Gene
Content:
Murine IL-15 gene (intronless ORF) from the ATG to the stop codon. - 1 disk of lyophilized GT100 E. coli bacteria transformed by pORF9-mIL-15.
- GT100 genotype is: F-, mcrA , Δ(mrr-hsdRMS-mcrBC) , Ø80lacZ∆M15 , • SV40 pAn: The Simian Virus 40 late polyadenylation signal enables eff i c i e n t
cleavage and polyadenylation reactions resulting in high levels of steady-state - 4 pouches of E. coli FastMedia™ Amp.
mRNA. The efficiency of this signal was first described by Carswell et al.3 Storage and stability:
- Products are shipped at room temperature.
References
- Transformed bacteria should be stored at -20°C and are stable up to 1 year.
1- Kim et al (1990). Gene 2: 217-223.
- Store E. coli FastMedia™ Amp at room temperature. FastMedia™ is stable 2- Takebe et al (1988). Mol. Cell Biol. 1: 466-472.
3- Carswell et al(1989). Mol. Cell Biol. 10: 4248-4258.
Quality control:
- Plasmid construct has been confirmed by restriction analysis and sequencing.
- Bacteria have been lyophilized, and their viability upon resuspension has Growth of pORF-transformed bacteria:
Use sterile conditions to do the following:
1- Resuspend the lyophilized E. coli by adding 1 ml of LB medium in the
GENERAL PRODUCT USE
tube containing the disk. Let sit for 5 minutes. Mix gently by inverting the pORF is a ready-made expression vector containing a gene of interest.
tube several times.
2- Streak bacteria taken from this suspension on an ampicillin LB agar plate prepared with the E. coli FastMedia™ Amp agar provided (see below).
Obtaining a gene to subclone into another vector. Two unique restriction
3- Place the plate in an incubator at 37˚C overnight. sites flank the gene, allowing convenient excision. These restriction sites are 4- Isolate a single colony and grow the bacteria in TB supplemented with compatible with many restriction sites contained in multiple cloning sites, thus ampicillin using the FastMedia™ Amp liquid provided (see below).
5- Extract the pORF plasmid DNA using the method of your choice.
Gene expression in mammalian cells. Cells may be transiently transfected with
p O R F. The secreted protein may be harvested in the cell culture supernatant as
Selection of bacteria with E. coli FastMedia™ Amp:
all secreted proteins in pORF possess a signal sequence.
E. coli FastMedia™ Amp is a n e w, fast and convenient way to prepare
liquid and solid media for bacterial culture by using only a microwave.
mIL-15 gene may be cut out by using BspH I and Nhe I enzymes
E. coli FastMedia™ Amp is a TB (liquid) or LB (solid) based medium BspH I is compatible with Nco I and BspLU11 I.
with ampicillin, and contains stabilizers. Nhe I is compatible with Xba I, Spe I, and Avr II.
E. coli FastMedia™ Amp can be ordered separately (catalog code # fas-am-l,fas-am-s, fas-am-x).
PLASMID FEATURES
• EF-1
α / HTLV hybrid pro m o t e r i s a composite promoter comprised of the
Elongation Factor- 1α ( E F - 1α) promoter1 and 5’ untranslated region of the 1- Pour the contents of a pouch into a clean borosilicate glass bottle or flask.
Human T-Cell Leukemia Virus (HTLV). EF-1α utilizes a type 2 promoter that 2- Add 200 ml of distilled water to the flask encodes for a "house keeping" gene. The promoter is stronger than CMV and is 3- Heat in a microwave on MEDIUM power setting (about 400Watts), until expressed at high levels in all cell cycles and lower levels during G0 phase. T h e bubbles start appearing (approximately 3 minutes). Do not heat a closed
promoter is also non-tissue specific; it is highly expressed in all cell types. T h e c o n t a i n e r. Do not autoclave FastMedia™.
R segment and part of the U5 sequence (R-U5’) of the HTLV Type 1 Long 4- Swirl gently to mix the preparation. Be careful, the bottle and media are
Terminal Repeat2 has been coupled to the EF-1α promoter to enhance stability hot, use heatproof pads or gloves and care when handling.
of DNA and RNA. This modification not only increases steady state transcription, 5- Reheat the media for 30 seconds and gently swirl again. Repeat as but also significantly increases translation efficiency possibly through mRNA necessary to completely dissolve the powder into solution. But be careful to avoid overboiling and volume loss.
• Ori colE1 is a minimal E. coli origin of replication with the same activity as
6- Let agar medium cool to 45˚C before pouring plates. Let liquid media cool • Amp (ampicillin resistance gene): The ampicillin resistance gene allows the
N o t e : Do not reheat solidified FastMedia™ as the antibiotic will be
selection of bacteria carrying the pORF plasmid.
permanently destroyed by the pro c e d u re . TECHNICAL SUPPORTToll free (US): 888-457-5873Outside US: (+1) 858-457-5873E-mail: [email protected] NotI (3361)
XhoI (3356)
BspHI (569)
pORF9-mIL-15
NheI (1093)
SwaI (1355)
1 GGATCTGCGATCGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTA 101 GAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCC 201 GTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGCTGAAGCTTCGAGG GGCTCGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTGAGGCC 301 GCCATCCACGCCGGTTGAGTCGCGTTCTGCCGCCTCCCGCCTGTGGTGCCTCCTGAACTGCGTCCGCCGTCTAGGTAAGTTTAAAGCTCAGGTCGAGACC 401 GGGCCTTTGTCCGGCGCTCCCTTGGAGCCTACCTAGACTCAGCCGGCTCTCCACGCTTTGCCTGACCCTGCTTGCTCAACTCTACGTCTTTGTTTCGTTT BspHI (569)
501 TCTGTTCTGCGCCGTTACAGATCCAAGCTGTGACCGGCGCCTACCTGAGATCACCGGTAGGAGGGCCATCATGAAAATTTTGAAACCATATATGAGGAAT 601 ACATCCATCTCGTGCTACTTGTGTTTCCTTCTAAACAGTCACTTTTTAACTGAGGCTGGCATTCATGTCTTCATTTTGGGCTGTGTCAGTGTAGGTCTCC 11 T h r S e r I l e S e r C y s T y r L e u C y s P h e L e u L e u A s n S e r H i s P h e L e u T h r G l u A l a G l y I l e H i s V a l P h e I l e L e u G l y C y s V a l S e r V a l G l y L e u P 701 CTAAAACAGAGGCCAACTGGATAGATGTAAGATATGACCTGGAGAAAATTGAAAGCCTTATTCAATCTATTCATATTGACACCACTTTATACACTGACAG 44 r o L y s T h r G l u A l a A s n T r p I leAspValArgTyrAspLeuGluLysI l e G l u S e r L e u I l e G l n S e r I l e H i s I leAspThrThrLeuTyrThrAspSe 801 TGACTTTCATCCCAGTTGCAAAGTTACTGCAATGAACTGCTTTCTCCTGGAATTGCAGGTTATTTTACATGAGTACAGTAACATGACTCTTAATGAAACA 77 rAspPheHisProSerCysLysValThrAlaMetAsnCysPheLeuLeuGluLeuGlnVal I leLeuHisGluTyrSerAsnMetThrLeuAsnGluThr 901 GTAAGAAACGTGCTCTACCTTGCAAACAGCACTCTGTCTTCTAACAAGAATGTAGCAGAATCTGGCTGCAAGGAATGTGAGGAGCTGGAGGAGAAAACCT111 V a l A r g A s n V a l L e u T y r L e u A l a A s n S e r T h r L e u S e r S e r A s n L y s A s n V a l A l a G l u S e r G l y C y s L y s G l u C y s G l u G l u L e u G l u G l u L y s T h r P NheI (1093)
1001 TCACAGAGTTTTTGCAAAGCTTTATACGCATTGTCCAAATGTTCATCAACACGTCCTGACTGCACGCGAGCCTCTTCCGTGTTTCTGTTATTGCTAGCTC
144 h e T h r G l u P h e L e u G l n S e r P h e I l e A r g I l e V a l G l n M e t P h e I leAsnThrSer••• 1101 GACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTG 1201 TGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGG SwaI (1355)
1301 GAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTAGATCCATTTAAATGTTAATTAAGAACATGTGAGCAAAAGGCCAGCAAAAGG
1401 CCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAA 1501 CCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTT 1601 CTCCCTTCGGGAAGCGTGGCGCTTTCTCATA GCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCC
1701 CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAG 1801 GATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTG 1901 CTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTA 2001 CGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGCA 2101 TGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATT 1 M e t S e r I l e G l n H i s P h e A r g V a l A l a L e u I l e P r o P h e P h e A l a A l a P h 2201 TTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAAC 17 e C y s L e u P r o V a l P h e A l a H i s P r o G l u T h r L e u V a l L y s V a l L y s A s p A l a G l u A s p G l n L e u G l y A l a A r g V a l G l y T y r I leGluLeuAspLeuAsn 2301 AGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACG 51 S e r G l y L y s I l e L e u G l u S e r P h e A r g P r o G l u G l u A r g P h e P r o M e t M e t S e r T h r P h e L y s V a l L e u L e u C y s G l y A l a V a l L e u S e r A r g I leAspA 2401 CCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGT 84 l a G l y G l n G l u G l n L e u G l y A r g A r g I l e H i s T y r S e r G l n A s n A s p L e u V a l G l u T y r S e r P r o V a l T h r G l u L y s H i s L e u T h r A s p G l y M e t T h r V a 2501 AAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTG 117 l A r g G l u L e u C y s S e r A l a A l a I leThrMetSerAspAsnThrAlaAlaAsnLeuLeuLeuThrThrI l e G l y G l y P r o L y s G l u L e u T h r A l a P h e L e u 2601 CACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAA 151 H i s A s n M e t G l y A s p H i s V a l T h r A r g L e u A s p A r g T r p G l u P r o G l u L e u A s n G l u A l a I leProAsnAspGluArgAspThrThrMetProValAlaM 2701 TGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACC 184 e t A l a T h r T h r L e u A r g L y s L e u L e u T h r G l y G l u L e u L e u T h r L e u A l a S e r A r g G l n G l n L e u I l e A s p T r p M e t G l u A l a A s p L y s V a l A l a G l y P r 2801 ACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGAT 217 o L e u L e u A r g S e r A l a L e u P r o A l a G l y T r p P h e I l e A l a A s p L y s S e r G l y A l a G l y G l u A r g G l y S e r A r g G l y I l e I l e A l a A l a L e u G l y P r o A s p 2901 GGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTA 251 G l y L y s P r o S e r A r g I l e V a l V a l I l e T y r T h r T h r G l y S e r G l n A l a T h r M e t A s p G l u A r g A s n A r g G l n I l e A l a G l u I l e G l y A l a S e r L e u I l e L 3001 AGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGA 3101 TAATCTCATGCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCA3201 GCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTT NotI (3361)
XhoI (3356)
3301 AACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGGTGACCGGATCTCGAGCGGCCGCAATAAAATATCTTTATTTTCATTACATCTGTG3401 TGTTGGTTTTTTGTGTGAATCGTAACTAACATACGCTCTCCATCAAAACAAAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCA3501 GGTGCCAGAACATTTCTCTATCGAA

Source: http://invivogen.net/PDF/pORF9-mIL-15_TDS.pdf?PHPSESSID=9b9acc4fd6d015c1e32a5ccb67c4b3df

Vara_2013_-_ kavarna

KAVARNA - VARA 2013 LISTA HOTELURI: (CTRL + Click in lista de mai jos, pentru a accesa direct hotelul dorit) LIGHTHOUSE GOLF & SPA RESORT 5* . 2 APARTHOTEL ROYAL BAY 4* . 3 APARTHOTEL ROYAL COVE RESIDENCE 3*+ . 3 APARTHOTEL VILLA ALLEGRA 3* . 3 KALIAKRIA APARTHOTEL 3* . 4 LIGHTHOUSE GOLF & SPA RESORT 5* Localizare: Complexul este situat la 5 km nord de Balchik. In

Bioetica 71.indd

El artículo analiza el derecho a la objeción de conciencia de los profesionales sanitarios en las sociedades multiculturales. Se sostiene la tesis de que el relativismo ético que caracteriza a estas sociedades convive con un aparentemente paradójico recorte del ejercicio del derecho a la objeción de conciencia. «Aparentemente» por-que, en el fondo, el relativismo ético tiende a la adopci

Copyright © 2011-2018 Health Abstracts